firstpreviousnext

[1-100] [101-200] [201-300] [301-400] [401-500] [501-600] [601-700] [701-800] [801-900] [901-1000] [1001-1100] [1101-1200] [1201-1300] [1301-1400] [1401-1500] [1501-1600] [1601-1700] [1701-1800] [1801-1900] [1901-2000] [2001-2100] [2101-2200] [2201-2300] [2301-2400] [2401-2411]


18S rDNA from 40 beetle species

Data matrix used in Maddison, D.R., Baker, M.D., and Ober, K.A. In press.A preliminary phylogenetic analysis of 18S ribosomal DNA of carabid beetles (Coleoptera: Carabidae). Boll. Mus. reg. Sci. nat. Torino.

Sites 501 through 600

Calybe        CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGACCAATTGGAGGGCAAGTCTGGTGCCA
Cymindis      CAAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGATTACACTTTAAATCCTTTAAAAAGGACCAATTGGAGGGCAAGTCTGGTGCCA
Amara         CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACCAATTGGAGGGCAAGTCTGGTGCCA
Agonum        CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACCAATTGGAGGGCAAGTCTGGTGCCA
Discoderus    CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACCAATTGGAGGGCAAGTCTGGTGCCA
Chlaenius     CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGACCAATTGGAGGGCAAGTCTGGTGCCA
Loxandrus     CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACCAATTGGAGGGCAAGTCTGGTGCCA
Pterostichus  CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACCAATTGGAGGGCAAGTCTGGTGCCA
Galerita      CAAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGATCTATTGGAGGGCAAGTCTGGTGCCA
Pseudaptinus  CAAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGATCTATTGGAGGGCAAGTCTGGTGCCA
Pseudomorpha  CAAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGATCTATTGGAGGGCAAGTCTGGTGCCA
Morion        CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGATCTATTGGAGGGCAATTCTGGTGCCA
Psydrus       CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTGATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACCCATTGGAGGGCAAGTCTGGTGCCA
Diplous       CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACCCATTGGAGGGCAAGTCTGGTGCCA
Patrobus      CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTATAACAAGGACCAATTGGAGGGCAAGTCTGGTGCCA
Zolus         CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGGACACTTTAAATCCTTTCAAAATGACCAATTGGAGGGCAAGTCTAGTGCCA
Sloaneana     CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACCAATTGGAGGGCAAGTCTAGTGCCA
Diplochaetus  CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGACCAATTGGAGGGTAAGTCTGGTGCCA
Pericompsus   CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGACCAATTGGAGGGCAAGTCTGGTGCCA
Bembidion     CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTATAACAAGGACCAATTAGAGGGCAAGTCTGGTGCCA
Asaphidion    CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGAACACTTTAAATCCTATAACAATAAACAATTAGAGGGCAAGTCTGGTGCCA
Trechus       CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGACCAATTGGAGGGTAAGTCTGGTGCCA
Pasimachus    CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGACCAATTGGAGGGCAAGTCTGGTGCCA
Scarites      CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGACCAATTGGAGGGCAAGTCTGGTGCCA
Clivina       CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATACTTTAACGAGGACCAATTGGAGGGTAAGTCTGGTGCCA
Schizogenius  CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACCCATTGGAGGGCAAGTCTGGTGCCA
Dyschirius    CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGATCAATTGGAGGGCAAGTCTGGTGCCA
Loricera      CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGACCAATTGGAGGGCAAGTCTGGTGCCA
Calosoma      CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGATCAATTGGAGGGCAAGTCTGGTGCCA
Scaphinotus   CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGATCAATTGGAGGGCAAGTCTGGTGCCA
Elaphrus      CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGAACACTTTAAATCCTTTAACAATAAACAATTGGAGGGTAAGTCTGGTGCCA
Blethisa      CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGACCCATTGGAGGGCAAGTCTGGTGCCA
Notiophilus   CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGATCAATTGGAGGGCAAGTCTGGTGCCA
Nebria        CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTAAAACAAGGACCAATTGGAGGGCAAGTCTGGTGCCA
Leistus       CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACAAGGAACAATTGGAGGGCAAGTCTGGTGCCA
T. holmbergi  CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGATCAATTGGAGGGCAAGTCTGGTGCCA
T. gibbsii    CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTTTAAATCCTTTAACGAGGATCAATTGGAGGGCAAGTCTGGTGCCA
Tenebrio      CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTCTAAACCCTTTAACGAGGATCAATTGGAGGGCAAGTCTGGTGCCA
Dynastes      CGAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTCTAAACCCTTTAACGAGGATCAATTGGAGGGCAAGTCTGGTGCCA
Xanthopygus   CAAAAAATAACGATACGGGACTCATCCGAGGCCCCGTAATCGGAATGAGTACACTCTAAACCCTTTAACGAGGATCAATTGGAGGGCAAGTCTGGTGCCA
                                                                                                                  
Character excluded from all analyses indicated by a = in the line under the matrix; boundary regions indicated by *